Give reasons: ‘Genetic code is universal’.

Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

Differentiate - Template strand and coding strand.

Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?

Why tRNA is called an adapter molecule?

Name the anticodon required to recognize the following codons: AAU, CGA, UAU, and GCA.

If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA?

HGP is the windows for treatment of various genetic disorders. Justify the statement.