What is the difference between syngamy and fertilization?

Explain the role of oxytocin and relaxin in parturition and lactation.

The procedure of GIFT involves the transfer of female gametes into the fallopain tube, can gametes be transferred to the uterus to achieve the same result? Explain.

Explain the inheritance of sex linked characters in human being.

If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA?

Explain the formation of a nucleosome.

Mention any three similarities found common in Neanderthal man and Homo sapiens.

List the common withdrawal symptoms of drugs and alcohol abuse.

List the advantages of biogas plants in rural areas.

Explain why cloning of Dolly, the sheep was such a major scientific breakthrough?

Describe Population Age Distribution

‘Stability of a community depends upon its species diversity’ Justify the statement.

Describe how deforestation might contribute to global warming

‘Pollination in Gymnosperms is different from Angiosperms’ – Give reasons.

Give a concise account on steps involved in fertilization of an angiosperm plant.

Differentiate continuous variation with discontinuous variation.

How sex is determined in monoecious plants. write their genes involved in it.

Write the advantages and disadvantages of Bt cotton.

Give an account on Cryopreservation.

How is anemochory differ from zoochory?

Explain different types of hydrophytes with examples.

Draw a pyramid from following details and explain in brief.
Quantities of organisms are given-Hawks - 50, plants - 1000.rabbit and mouse - 250 + 250, pythons and lizard - 100 + 50 respectively.

Suggest a solution to water crisis and explain its advantages.

Write a note on heterosis.

Write the economic importance of rice.