A natural ecosystem is the result of interactions between organisms and the environment. For example, an ocean is classified as a marine ecosystem, which consists of algae, consumers and decomposers.
1.Grassland Ecosystem. Its main characteristic is it is inclusive of non-woody vegetation cover. 
2.Temperate Forest Ecosystems. The ecosystem is common in regions that experience warm summers and cold winters.
3.Tropical Rainforest System.
4.Desert Ecosystem.
5.Coral Reefs.

Codingstrand-5'
TACGTACGTACGTACGTACGTACG 3'
mRNAstrand-5'
UACGUACGUACGUACGUACGUACG 3'

(a) Hermaphroditism
(b) Parthenogenesis
(c) Endometrium
(d) Corpus Albicans

- Restriction endonuclease, EcoRI cuts the DNA strands a little away from the centre of the palindromic, sequence, but between the same two bases on the two strands.
\({ 5 }^{ ' }-\begin{matrix} { G }^{ \downarrow } & A \end{matrix}\begin{matrix} A & T \end{matrix}\begin{matrix} T & C \end{matrix}-{ 3 }^{ ' }\)
\({ 3 }^{ ' }-\begin{matrix} { C } & T \end{matrix}\begin{matrix} T & A \end{matrix}\begin{matrix} { A }_{ \uparrow } & G \end{matrix}-{ 5 }^{ ' }\)
This leaves single-stranded portions, called sticky ends, overhanging at the end of each strand.
Since, the stickiness facilitates the action of DNA ligase, they easily form hydrogen bonds with their complementary counterparts.

The two layers of seed coat are:
(i) Testa
Testa is formed from the outer integument.
(ii) Tegmen
Tegmen is formed from the inner integument.

(a) Restriction endonuclease.
(b) Agarose gel.
(c) Nitrocellulose/nylon/synthetic membrane.
(d) Variable Number Tandem Repeats (VNTR).
(e) Hybridisation with VNTR probe.
(/) Autoradiography.

Examples
1. Parthenocarpy is seen in banana.
2. Apomixis is seen in Citrus, mango, some members of Asteraceae and grasses. (anyone)
Similarity
1.There is no fertilisation involved in both parthenocarpy and apomixis.
Difference
1. Parthenocarpy is fruit formation without fertilisation; the fruits are seedless or the seeds are not viable.
2. Apomixis is seed formation without fertilisation; the seeds are viable

Factors that affect the rate of  decomposition are :
(i) Climatic factors.
(ii) Chemical composition of the detritus.
(iii) Temperature.
(iv) Soil moisture.

1. The technique that can help in the identification of victims is DNA fingerprinting which distinguishes between individuals of same species by using their DNA as sample. The chemical structure of DNA is same in everyone (99.9%) except the order of base pairs, i.e. only 0.1% of DNA makes every individual unique. DNA fingerprinting exploits the highly variable repeating sequences, i.e. VNTRs for profiling. These VNTRs are highly conserved among members of the same species.
2. The presence of similarities between the victims and their relatives determines their association on the basis of which dead bodies can be identified and handed over to their families.

Biotechnology is the technique of using live organisms or their cellular components like enzymes for products and processes useful to mankind. It is mainly of two types:
(i) Traditional Biotechnology: This includes the useful processes which are based on the natural capabilities of micro organisms such as production of curd, cheese, beer, wine, vinegar etc.
(ii) Modem Biotechnology: This includes the genetic engineering. This is based on gene manipulation and the development of the recombinant DNA technlogy. Production of DNA vaccine, correction of defective gene, formation of monoclonal antibodies, in-vitro fertilization are also the part of modem biotechnology.

1.After implantation interdigitation of maternal and foetal tissues results in formation of structural and functional unit between embryo and maternal body called placenta. 
2.It facilitates supply of oxygen and nutrients to the embryo, removal of carbon dioxide. and excretory matenal. Also acts as endocnne tissue and produces hormones like hCG, hPL, estrogen, progesterone, relaxin.

initiation of polypeptide synthesis:
1)  The ribosome, in its inactive state, exists as two subunits-a large subunits and a small subunit.
2) When the small subunit encounter the mRNA translation begins
3) The mRNA binds to the small subunit of ribosomes, following base pair rule, between the bases of mRNA and those on rRNA. It is catalyst by certain 'initiation factors
4) There are two sites on the larger subunits, the P site and the A-site
5) The small subunit (with the tRNA attaches to the large subunits in such a way that the initiation codon (AUG) comes on the P-site
6) The Initiator tRNA (methionyl-tRNA) binds to the P-site
Function: It starts the transcription
In eukaryotes, there is at least three RNA polymerase in addition to those found in cell organelles.
(a) RNA-Polymerase I transcribe RNAs (28 S, 18 S and 5,8 S
(b) RNA-Polymerase II transcribe the processor of mRNA called heterogeneous nuclear RNA (tRNA)
(c) RNA-Polymerase III transcribe tRNA (5S rRNA, %S nRNAs)

1.As the name suggests; double fertilisation involves two types of fertilisation-syngamy and triple fusion. The release of two male gametes into the cytoplasm of one of the synergids causes its degeneration.
2.One male gamete fuses with the egg cell to form a diploid zygote (which later forms embryo). This process is called syngamy or generative fertilisation. The other male gamete fuses with the two polar nuclei in the central cell by a process called triple fusion, which results in the formation of a triploid. 
3.Primary Endosperm Nucleus (PEN) and the central cell becomes the Primary Endosperm Cell (PEe). This PEC divides repeatedly to form triploid endosperm tissue which further undergoes successive free nuclear divisions to give rise to free nuclear endosperm (free-nuclei).
4.This stage is followed by the wall formation around the cellular endosperm. Thus, the events of double fertilisation are immediately followed by post-fertilisation events involving development of endosperm.

For initiation, the ribosome binds to the mature mRNA at the start codon (AUG) that is recognized by the initiator t-RNA. During elongation, charged t-RNA sequentially binds to the appropriate codon in m-RNA with the anticodon present on t-RNA. The ribosome moves from one codon to another adding amino acids one after the other to form polypeptide, i.e. translation. During termination, the release factor binds to stop codon (UAA,UAG, UGA), terminating translation and releasing the polypeptide chain.

(i) Restriction enzymes are derived from a defence unit called restriction modification system which protects the microorganisms from harm.
(ii) They are called as molecular scissors because they cut DNA molecules at specified location indicated by presence of specific recognition sequence.
(iii) No, the strands cut from within are joined by another enzyme called DNA ligase. This joining is either with self or with another different strand.
(iv) Varun is curious, has scientific temperament and ask quick and intelligent questions.

(i) (c)
(ii) (b)
(iii) (a) : Relaxin increases the flexibility of the pubis symphysis and ligaments of sacroiliac and sacrococcygeal joints and helps to dilate the uterine cervix during labour pains.
(iv) (a) : hPL, hCG and relaxin are produced in women only during pregnancy.
(v) (b)

(a) If both Assertion and Reason are true and Reason is the correct explanation of Assertion.
Explanation:
Geitonogamy is a type of pollination in which pollen grains of one flower are transferred to the stigma of another flower belonging to either the same plant or genetically similar plant. It usually occurs in plants which show monoecious condition (unisexual male and female flowers borne on the same plant. Thus, geitonogamy is functionally cross pollination as it involves pollinating agent to carry out pollination, but genetically it is similar to autogamy (self-pollination) since the pollen grains come from the genetically same plant.

(b) Both assertion and reason are true but reason is not the correct explanation of assertion.

(b): The "core' enzyme which catalyses covalent chain extension, consists of two a - polypeptides (each of molecular weight about 41,000), one S - polypeptide ( molecular weight about 155,000) one S'-polypeptide (molecular weight about 165,000) and one ro-polypeptide (molecular weight about 12,000). The "holoenzyme" contains in addition, a -polypeptide (molecular weight about 95,000). The presence of the sigma factor is required for initiation at the proper transcription initiation (or promoter) sites. After each RNA chain - initiation event, sigma is released and the core enzyme catalyses chain elongation.